... 2) initiation 에는 <주도>라는 뜻이 없고 비슷한 <창설, 개시>라는 뜻만 있어서 주도하다 - 라는 뜻으로는 take initiative 만 쓰입니다.
태그:
해외배송 주문조회를 해보았는데요 Failed Order Initiation라고 뜨네요 뜻이 주문 실패인지 아니면 아직 주문이 안들어간거인지..무슨뜻인가요 음.. 둘다 결과적으로 같은...
태그:
... +_+ INITIATION F : There's always pain in evolution Giving birth, a life... our initiation M : Where am I? Please tell me the truth Where am I? Free me...
태그:
... 5'UAAGUGAAAGAUGUGAAUGAAGUAGCCACCAAAGUCAGUAAUGCUUCCAACA3' 위의 시퀀스에서 translation 이 시작되기 위해서는 initiation codon 이 AUG 이라는 것을 알고 있다면 그...
태그:
... I ain't going through no initiation. 부정이 두개가 들어가서 헷갈리는데 제가 생각할땐... I ain't going through no initiation. 부정이 두개가 들어가서 헷갈리는데 제가 생각할땐...
태그:
initiative와 initiation 차이가 무엇인가요? 문제 : Barner Corporation's record... 답이 initiative라는데 initiation은 왜 안될까요?? initiative와 initiation 차이가...
... initiation&drive response inhibition task persistence organization generative thinking awareness initiation... planning initiation attention/memory arousal/inhibition...
태그:
임상 시험 관련 단어인거같은데 initiation visit... 3 initiation visit 이거 해석좀요 ㅠㅠ... 3 initiation visit 절차 4,1 준비사항 – 비밀 유지...
태그:
... the initiation of removal proceedings. 이거... the initiation of removal proceedings. 설령 그렇지... (the initiation of removal proceedings), but not limited to (the...
태그:
... 마지막으로 translation 의 단계 initiation... 이러한 mRNA, tRNA, small subunit을 initiation complex라고... 되어 initiation complex가 해체되고 새로 만들어진...
태그: